Workshop#3

 

1. Consider the sequence

GAACTCATACGAATTCACGTCAGCCCATCGTGCCACGT

 

Use a window of 3 nucleotides and slide the window 1 nucleotide at a time. Calculate the %G+C as a function of nucleotide number. You may use an Excel spreadsheet and create a plot. Change the window to 5 nucleotides and create a second plot. Overlap the two plots. Show your instructor the spread sheet and the graph.

 

2. Given the following sequence: PLSQETFSDLWKLLPENNVLSP use the Kyte/Doolittle Hydropathy scale and a sliding window of 7 amino acids to construct a hydropathy plot.

 

3. Find the protein sequence for bacteriorhodopsin. Make sure you obtain the full-length sequence. Find the Kyte-Doolittle Hydropathy program software at the Expasy Tools website (TGREASE). Perform Kyte-Doolittle analysis of bacteriorhodopsin. Compare the plot to the one displayed in lecture today. Are there differences in the two plots? If so, why?

 

4. Import the human p53 (Accession number AAH03596) and squid p53 (Accession number AAA98563) sequences from the protein databases at NCBI onto your hard drive in FASTA format. This can be accomplished by changing the display format on the ENTREZ screen to FASTA. Highlight the entry and copy onto clipboard. Open NotePad on your local hard drive. Paste each sequence into a separate document and save them in a folder named "sequence" on C drive. Name the documents p53_human and p53_squid.

Type dotter c:\sequence\p53_human.txt c:\sequence\p53_human.txt RETURN

Do you detect some parallel lines? Why? What does the greyramp tool do?

Capture the image and save..

Type dotter c:\sequence\p53_human.txt c:\sequence\p53_squid.txt RETURN

What are the differences between the human vs. human comparison and the human vs. squid comparison? 

 
  Return to the Bioinformatics Home Page