Workshop A

You will be assigned a disease. List symptoms, find a chromosome location, gene sequence, and protein sequence associated with your disease.

1) Bloom's syndrome

2) Werner's syndrome

3) Familial hypercholesterolemia

4) Lynch syndrome

5) Cockayne syndrome

6) Hutchinson-Gilford Progeria

7) Li-Fraumeni syndrome

8) Ataxia-Telangiectasia

9) Breast Cancer 1

10) Cleft-palate

11) Familial adenomatous polyposis-1

12) Complete congenital stationary night blindness

13) Duchenne muscular dystrophy

14) Cystic fibrosis

15) Huntington disease

Workshop B

Do problems 1 from the end of Chapter 5 Bioinformatics Text. It is listed here:

1. Consider the sequence GAACTCATACGAATTCACGTCAGCCCATCGTGCCACGT

Create a %(G+C) plot of this sequence.  On the y axis will be %(G+C) and on the x axis will be the nucleotide sequence number.  Use a sliding window of 3 nucleotides and slide the window 1 nucleotide at a time. Calculate the %G+C as a function of nucleotide sequence number. You may use spreadsheet program to create the plot. Change the sliding window to 5 nucleotides and create a second plot. Overlap the two plots. Explain any differences in the two plots.